Molecular and morphometric characterization of root lesion nematode Pratylenchus thornei Sher and Allen, 1953 from hazelnut orchards in Ordu, Turkey

F. Akyazi, S. Joseph, A.F. Felek, T. Mengistu
Root-lesion nematode Pratylenchus thornei is one of the most economically important and widely distributed species worldwide. Hazelnut (Corylus avellana L.) is a main perennial crop in Turkey. This study reports the molecular and morphological characterization of P. thornei from hazelnut orchards from Ordu province. In June 2016, soil samples were collected from around the roots of hazelnut trees in Ordu. Nematodes were extracted from soil using a modified Baermann funnel method. The standard morphometric characters were measured for root-lesion nematodes and compared with previous studies. For molecular characterization, DNA was extracted from adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA. The PCR product was purified and sequenced. The sequence was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 100% with P. thornei (e.g., GenBank Accession Nos. KT213559.1, and JX261954.1). This study indicated that P. thornei is the species occurring on hazelnut in Ordu provinces, Turkey.
Akyazi, F., Joseph, S., Felek, A.F. and Mengistu, T. (2018). Molecular and morphometric characterization of root lesion nematode Pratylenchus thornei Sher and Allen, 1953 from hazelnut orchards in Ordu, Turkey. Acta Hortic. 1226, 399-406
DOI: 10.17660/ActaHortic.2018.1226.61
https://doi.org/10.17660/ActaHortic.2018.1226.61
D2-D3, hazelnut, Pratylenchus thornei, root-lesion nematodes, Turkey
English
1226_61
399-406

Acta Horticulturae